Sequence 908 (hCAP-H2 (RH2-1) , hCAPH2 (RH21) )
From Wikisequences
| Sequence hCAP-H2 (RH2-1) , hCAPH2 (RH21) | |
|---|---|
| Target | NCAPH2 ( Homo sapiens ) |
| Description | Non-SMC condensin II complex, subunit H2
Ensembl: ENSG00000025770 UniGene: Hs.180903 EntrezGene: 29781 Ensembl Chr22: 49293532 - 49308767 Strand: 1 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GGATTTCAGGATGAACACGTT / siRNA antisense (21b) CGTGTTCATCCTGAAATCCTT |
| Application | gene silencing |
| Name | hCAP-H2 (RH2-1) , hCAPH2 (RH21) |
References
Spatial and temporal regulation of Condensins I and II in mitotic chromosome assembly in human cells.Ono T, Fang Y, Spector DL, Hirano T.Mol Biol Cell. 2004 Jul;15(7) :3296-308. Epub 2004 May 14.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
