Sequence 913 (SRC1b)

Sequence SRC1b
Target	NCOA1 ( Homo sapiens )
Description	Nuclear receptor coactivator 1 Ensembl: ENSG00000084676
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GTGATGACTCGTGGCACTGTT / siRNA antisense (21b) CAGTGCCACGAGTCATCACTT
Application	gene silencing
Name	SRC1b

References

Progesterone and glucocorticoid receptors recruit distinct coactivator complexes and promote distinct patterns of local chromatin modification.Li X, Wong J, Tsai SY, Tsai MJ, O'Malley BW.Mol Cell Biol. 2003 Jun;23(11) :3763-73.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Onate et al. (1995) showed that SRC1 enhances the transcriptional activity of ligand-bound PGR but does not alter the basal activity of the target promoter. SRC1 also enhances estrogen receptor (ESR; 133430), glucocorticoid receptor (GRL; 138040), thyroid hormone receptor (e.g., 190120), and retinoid X receptor (e.g., RXRA; 180245) transcriptional activities through their cognate DNA response elements in the presence of hormone. Studies of the effects of SRC1 on unrelated transactivators showed that SRC1 can enhance the transcriptional activities of SP1 (189906) and the chimeric Gal4-VP16 protein, but not those of E2F (e.g., 189971), E47 (147141), or CREB (123810). Coexpression of SRC1 with PGR and ESR reversed the ability of ESR to squelch activation by PGR, suggesting that SRC1 is a limiting factor necessary for efficient PGR and ESR transactivation. A C-terminal form of SRC1 containing the receptor-binding region acted as a dominant-negative repressor of endogenous SRC1 function.

In vitro binding studies by Takeshita et al. (1996) showed that SRC1 can bind to TBP (600075) and to TFIIB (189963), in addition to a variety of nuclear hormone receptors in a ligand-dependent manner, suggesting that SRC1 may play a role as a bridging molecule between nuclear hormone receptors and general transcription factors. The conserved AF-2 region of nuclear hormone receptors was not required for receptor-SRC1 binding.

To dissect the role of SRC1 in PGR transactivation, Liu et al. (1999) used a cell-free transcription system with chromatin templates. They reported the successful reconstitution of ligand-dependent and PGR-dependent transcription using chromatin. They showed that, consistent with their previously proposed hypothesis (Jenster et al., 1997), the addition of liganded PGR to preassembled chromatin led to the reconfiguration of nucleosome structure in the vicinity of its binding site. This study suggested a dual role for SRC1 in PGR-mediated transactivation: SRC1 is involved in both chromatin remodeling and the process of recruitment/stabilization of general transcription factors. Animal Model.Picard et al. (2002) found that Tif2 (601993) -/- mice were protected against obesity and displayed enhanced adaptive thermogenesis, whereas Src1 -/- mice were prone to obesity due to reduced energy expenditure. In white adipose tissue, lack of Tif2 decreased Pparg (601487) activity and reduced fat accumulation, whereas in brown adipose tissue, it facilitated the interaction between Src1 and Pgc1-alpha (604517), which induced the thermogenic activity of Pgc1-alpha. A high-fat diet increased the Tif2/Src1 expression ratio, which may have contributed to weight gain. These results revealed that the relative level of TIF2/SRC1 can modulate energy metabolism.

Ye et al. (2005) developed transgenic androgen receptor (AR; 313700)-reporter mice and crossed them with Src1 or Tif2 knockout mice to analyze the contributions of Src1 and Tif2 to AR activity in testis. In vivo imaging and reporter gene assays showed that testicular AR activity was decreased significantly in mice with the Tif2 +/- mutation, but not in those with an Src1 +/- background, suggesting that Tif2 is the preferential coactivator for AR in testis. Immunohistologic analysis confirmed that AR and Tif2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although Src1 concentrated in Sertoli cell nuclei in the absence of Tif2, nuclear Src1 did not rescue AR activity in the Tif2 mutant background. Src1 appeared to negatively influence AR activity, whereas Tif2 stimulated AR activity.