Sequence 917 (Nek6
| Sequence Nek6#2 | |
|---|---|
| Target | NEK6 ( Homo sapiens ) |
| Description | NIMA ( never in mitosis gene a )-related kinase 6
Ensembl: ENSG00000119408 UniGene: Hs.197071 EntrezGene: 10783 Ensembl Chr9: 126059706 - 126155407 Strand: 1 GO terms: 0000166 0000287 0004672 0004674 0004713 0004871 0005515 0005524 0005634 0005737 0006468 0006915 0007049 0007059 0007067 0016740 0030071 0043123 0051301 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GCTCGGTGACCTTGGTCTGTT / siRNA antisense (21b) CAGACCAAGGTCACCGAGCTT |
| Application | gene silencing |
| Name | Nek6#2 |
References
The serine/threonine kinase Nek6 is required for cell cycle progression through mitosis.Yin MJ, Shao L, Voehringer D, Smeal T, Jallal B.J Biol Chem. 2003 Dec 26;278(52) :52454-60. Epub 2003 Oct 16.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Description. The Aspergillus nidulans 'never in mitosis A' (NIMA) gene encodes a serine/threonine kinase that controls initiation of mitosis. NIMA-related kinases (NEKs) are a group of protein kinases that are homologous to NIMA. Evidence suggests that NEKs perform functions similar to those of NIMA.
