Sequence 918 (Neo-1 , Neo1)
From Wikisequences
| Sequence Neo-1 , Neo1 | |
|---|---|
| Target | Neo ( Hepatitis C virus ) |
| Description | |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) ATGGATTGCACGCAGGTTCTT / siRNA antisense (21b) GAACCTGCGTGCAATCCATTT |
| Application | gene silencing |
| Name | Neo-1 , Neo1 |
References
Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.Antiviral Res. 2004 Jan;61(1) :49-55.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
