Sequence 922 (siNrf2

Sequence siNrf2#3 , siNrf2#3
Target	NFE2L2 ( Homo sapiens )
Description	Nuclear factor ( erythroid-derived 2 )-like 2 Ensembl: ENSG00000116044 UniGene: Hs.155396 EntrezGene: 4780 Ensembl Chr2: 177803279 - 177965671 Strand: -1 GO terms: 0003677 0003700 0005634 0005737 0006355 0006366 0016563 0030968 0043565 0045449 0045893 0045995 0046983
Design	shRNA
Chemistry	RNA
Sequence	(49b) GTCCCAGTGTGGCATCACCTTCAAGAGAGGTGATGCCACACTGGGACTT
Application	gene silencing
Name	siNrf2#3 , siNrf2#3

References

Nitric oxide-induced transcriptional up-regulation of protective genes by Nrf2 via the antioxidant response element counteracts apoptosis of neuroblastoma cells.Dhakshinamoorthy S, Porter AG.J Biol Chem. 2004 May 7;279(19) :20096-107. Epub 2004 Feb 25.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. NFE2 (601490), NFE2L1 (163260), and NFE2L2 comprise a family of human genes encoding basic leucine zipper (bZIP) transcription factors. They share highly conserved regions that are distinct from other bZIP families, such as JUN (165160) and FOS (164810), although remaining regions have diverged considerably from each other (Chan et al., 1995).

Gene Function. Using a reporter gene assay, Moi et al. (1994) demonstrated that the putative N-terminal acidic transactivation domain of NRF2 was functional.

Superinduction of the SSAT gene (SAT1; 313020) is associated with the antineoplastic activity of several antitumor polyamine analogs. Wang et al. (1999) found that PMF1 (609176) mRNA was also induced in a lung tumor cell line sensitive to polyamine analogs, but it was not induced in an insensitive lung tumor cell line. Cotransfection of PMF1 and NRF2 activated transcription from the polyamine-responsive element of the SSAT promoter in a reporter assay, and PMF1 was the rate-limiting component. Wang et al. (1999) concluded that PMF1 mediates SSAT transcriptional induction by acting in cooperation with NRF2.

Wang et al. (2001) demonstrated that the NRF2-PMF1 interaction requires the leucine zipper region of NRF2 and the C-terminal coiled-coil region of PMF1. Mutations that interrupted either of these regions altered the ability of the proteins to interact, and they lost their ability to regulate transcription of the SSAT gene.

Using a yeast 2-hybrid assay, He et al. (2001) found that mouse Nrf2 interacted with rat Atf4 (604064). Coimmunoprecipitation and mammalian 2-hybrid analyses confirmed the interaction. An Nrf2-Atf4 dimer bound a stress response element sequence from an Nrf2 target gene, Ho1 (HMOX1; 141250). Additional experiments suggested that ATF4 regulates HO1 expression in a cell-specific manner, possibly in a complex with NRF2.

Using small-interfering RNA (siRNA) to disrupt DJ1 expression in a human nonsmall cell lung carcinoma cell line, Clements et al. (2006) showed that DJ1 (602533) was required for the expression of several genes, including the NRF2-regulated antioxidant enzyme NQO1 (125860). Without DJ1, NRF2 protein was unstable, and transcriptional responses were decreased both basally and after induction. DJ1 was indispensable for NRF2 stabilization by affecting NRF2 association with KEAP1 (606016), an inhibitor protein that promotes ubiquitination and degradation of NRF2.

Animal Model. Chan et al. (2001) found that Nrf2 knockout mice are highly susceptible to acetaminophen (APAP). With doses of APAP that were tolerated by wildtype mice, the Nrf2 -/- mice died of liver failure. When hepatic glutathione was depleted after a dose of 400 mg/kg of APAP, the wildtype mice were able to compensate and regain the normal glutathione level. In contrast, the glutathione level in the knockout mice was not compensated and remained low. The results highlighted the importance of Nrf2 in the regulation of glutathione synthesis and cellular detoxification processes.

Lee et al. (2004) reported that mice with targeted disruption of Nrf2 showed regenerative immune-mediated hemolytic anemia. A chronic increase in oxidative stress due to decreased antioxidant capacity sensitized erythrocytes and caused hemolytic anemia in Nrf2 -/- mice, suggesting a pivotal role of the Nrf2-antioxidant responsive element pathway in the cellular antioxidant defense system.

Rangasamy et al. (2004) reported that Nrf2 -/- mice had earlier-onset and more extensive cigarette smoke-induced emphysema than wildtype littermates. Emphysema in NRF2-deficient mice exposed to cigarette smoke for 6 months was associated with more pronounced bronchoalveolar inflammation, enhanced alveolar expression of a marker of oxidative stress, and an increased number of apoptotic alveolar septal cells. Microarray analysis identified expression of nearly 50 Nrf2-dependent antioxidant and cytoprotective genes in the lung that may work in concert to counteract cigarette smoke-induced oxidative stress and inflammation. Rangasamy et al. (2004) concluded that the responsiveness of the NRF2 pathway may act as a major determinant of susceptibility to cigarette smoke-induced emphysema by upregulating antioxidant defenses and decreasing lung inflammation and alveolar cell apoptosis.

Wildtype rodents have brownish-yellow incisors, the color representing iron content. Iron is deposited into the mature enamel by ameloblasts that outline enamel surface of the teeth. Yanagawa et al. (2004) found that genetically engineered Nrf2-deficient mice had grayish-white incisors. Micro x-ray imaging analysis revealed that the iron content of the Nrf2-deficient mouse incisors was significantly decreased compared to that of wildtype mice. Iron was aberrantly deposited in the papillary layer cells of the enamel organ in Nrf2-deficient mice, suggesting that the iron transport from blood vessels to ameloblasts was disturbed. Yanagawa et al. (2004) also found that ameloblasts of Nrf2 null mice showed degenerative atrophy at the late maturation stage, which gave rise to the loss of iron deposition to the surface of mature enamel. They concluded that the enamel organ of Nrf2-deficient mice has a reduced iron transport capacity, which results in both the enamel cell degeneration and disturbance of iron deposition onto the enamel surface.

Thimmulappa et al. (2006) observed that lipopolysaccharide (LPS) treatment, as well as cecal ligation and puncture (CLP), induced greater mortality and pulmonary inflammation, including Tnf (191160) secretion and Nfkb (see 164011) activity, in Nrf2 -/- mice compared with wildtype mice. Microarray and RT-PCR analyses showed that Nrf2 controlled the early surge of a number of proinflammatory cytokines and chemokines and their regulators, as well as antioxidative genes (e.g., GCLC; 606857). Immunoblot analysis showed greater degradation of Ikba (NFKBIA; 164008) and increased Ikk (see 600664) activity in Nrf2 -/- mice after treatment with either LPS or TNF. Luciferase reporter assays showed that N-acetyl-cysteine antioxidant pretreatment significantly attenuated Nfkb-mediated activity in Nrf2 -/- cells and abrogated LPS-induced proinflammatory gene expression in Nrf2 -/- mice. Thimmulappa et al. (2006) concluded that NRF2 regulates the innate immune response during sepsis and improves survival by maintaining redox homeostasis and restraining proinflammatory signaling.