Sequence 926 (p50 3 , p503)
From Wikisequences
Sequence p50_3 , p503 | |
---|---|
Target | Nfkb1 ( Mus musculus ) |
Description | Nuclear factor of kappa light chain gene enhancer in B-cells 1, p105
Ensembl: ENSMUSG00000028163 UniGene: Mm.256765 EntrezGene: 18033 Ensembl Chr3: 135247621 - 135354511 Strand: -1 GO terms: 0003700 0004966 0005515 0005634 0005737 0006355 0006915 0007165 0007186 0016021 0016566 0045083 0045449 0045892 0045944 0048535 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GAAAATGGCGGAGTTTGGGTT / siRNA antisense (21b) CCCAAACTCCGCCATTTTCTT |
Application | gene silencing |
Name | p50_3 , p503 |
References
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478