Sequence 931 (p75NTR-5 , p75NTR5)
Sequence p75NTR-5 , p75NTR5 | |
---|---|
Target | Ngfr ( Rattus norvegicus ) |
Description | Nerve growth factor receptor (TNFR superfamily, member 16)
Ensembl: ENSRNOG00000005392 UniGene: Rn.10980 EntrezGene: 24596 Ensembl Chr10: 84262802 - 84281006 Strand: -1 GO terms: 0005030 0005035 0005515 0005634 0005737 0005886 0006915 0006917 0007165 0007275 0007411 0007417 0009611 0016021 0016048 0021675 0030154 0042488 0043588 0048406 0048635 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GCGGAGCGCTGACGCCGGATT / siRNA antisense (21b) TCCGGCGTCAGCGCTCCGCTT |
Application | gene silencing |
Name | p75NTR-5 , p75NTR5 |
References
Disinhibition of neurotrophin-induced dorsal root ganglion cell neurite outgrowth on CNS myelin by siRNA-mediated knockdown of NgR, p75NTR and Rho-A.Ahmed Z, Dent RG, Suggate EL, Barrett LB, Seabright RJ, Berry M, Logan A.Mol Cell Neurosci. 2005 Mar;28(3) :509-23.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478