Sequence 932 (siNME1.1)
Sequence siNME1.1 | |
---|---|
Target | NME1 (Homo sapiens) |
Description | Non-metastatic cells 1, protein (NM23A) expressed in
Ensembl: ENSG00000011052 UniGene: Hs.463456 EntrezGene: 4830 Ensembl Chr17: 46585919 - 46604107 Strand: 1 GO terms: 0000166 0000287 0001726 0003677 0003700 0004536 0004550 0005515 0005524 0005634 0005737 0006183 0006228 0006241 0006350 0006355 0007049 0007155 0008285 0009117 0009142 0009209 0016301 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) AGTTGGCAGGAACATTATATT / siRNA antisense (21b) TATAATGTTCCTGCCAACTTG |
Application | gene silencing |
Name | siNME1.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478