Sequence 937 (scrambled)
From Wikisequences
Sequence scrambled | |
---|---|
Target | none |
Description | Control |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (20b) CCGTCGATTTCACCCGGGTT / siRNA antisense (20b) CCCGGGTGAAATCGACGGTT |
Application | gene silencing |
Name | scrambled |
References
Protein kinase A blocks Raf-1 activity by stimulating 14-3-3 binding and blocking Raf-1 interaction with Ras.Dumaz N, Marais R.J Biol Chem. 2003 Aug 8;278(32) :29819-23. Epub 2003 Jun 11.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478