Sequence 938 (scrambled)
From Wikisequences
Sequence scrambled | |
---|---|
Target | none |
Description | Control |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) ATGTGTGTACGTCTCCTCCTT / siRNA antisense (21b) GGAGGAGACGTACACACATTT |
Application | gene silencing |
Name | scrambled |
References
Effects of RNA interference-mediated silencing of gamma-secretase complex components on cell sensitivity to caspase-3 activation.Xie Z, Romano DM, Kovacs DM, Tanzi RE.J Biol Chem. 2004 Aug 13;279(33) :34130-7. Epub 2004 Jun 7.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478