Sequence 939 (scrambled)
From Wikisequences
Sequence scrambled | |
---|---|
Target | none |
Description | Control |
Design | shRNA |
Chemistry | RNA |
Sequence | (53b) AGTACGTGTACATGCGCCCTTTTCAAGAGAAAGGGCGCATGTACACGTACTTT |
Application | gene silencing |
Name | scrambled |
References
p21WAF1/CIP1 selectively controls the transcriptional activity of estrogen receptor alpha.Fritah A, Saucier C, Mester J, Redeuilh G, Sabbah M.Mol Cell Biol. 2005 Mar;25(6) :2419-30.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478