Sequence 941 (siCD98-1scr , siCD981scr)
From Wikisequences
| Sequence siCD98-1scr , siCD981scr | |
|---|---|
| Target | Control ( Homo sapiens ) |
| Description | Control |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) ATCACCTTAAGACGTTCGGTT / siRNA antisense (21b) CCGAACGTCTTAAGGTGATTT |
| Application | gene silencing |
| Name | siCD98-1scr , siCD981scr |
References
RNA interference-induced reduction in CD98 expression suppresses cell fusion during syncytialization of human placental BeWo cells.Kudo Y, Boyd CA.FEBS Lett. 2004 Nov 19;577(3) :473-7.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
