Sequence 944 (ctr)
From Wikisequences
Sequence ctr | |
---|---|
Target | Control ( Mus musculus ) |
Description | Control |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GTCAGTCAGTCAGTCAGTCTT / siRNA antisense (21b) GACTGACTGACTGACTGACTT |
Application | gene silencing |
Name | ctr |
References
Silencing of chromatin assembly factor 1 in human cells leads to cell death and loss of chromatin assembly during DNA synthesis.Nabatiyan A, Krude T.Mol Cell Biol. 2004 Apr;24(7) :2853-62.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478