Sequence 946 (siRNA-ctr , siRNActr)
From Wikisequences
| Sequence siRNA-ctr , siRNActr | |
|---|---|
| Target | none |
| Description | Control |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) AGGAGATATTTCGAGGCTTTT / siRNA antisense (21b) AAGCCTCGAAATATCTCCTTT |
| Application | gene silencing |
| Name | siRNA-ctr , siRNActr |
References
Prostaglandin E2 enhances pancreatic cancer invasiveness through an Ets-1-dependent induction of matrix metalloproteinase-2.Ito H, Duxbury M, Benoit E, Clancy TE, Zinner MJ, Ashley SW, Whang EE.Cancer Res. 2004 Oct 15;64(20) :7439-46.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
