Sequence 956 (ISIS-141923 , ISIS 141923)

From Wikisequences
Jump to: navigation, search
Sequence ISIS-141923 , ISIS 141923
Target none
Description Control
Design MOE gapmer
Chemistry moC*moC*moT*moT*moC*C*C*T*G*A*A*G*G*T*T*moC*moC*moT*moC*moC
Sequence CCTTCCCTGAAGGTTCCTCC
Application gene silencing
Name ISIS-141923 , ISIS 141923

References

Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders