Sequence 965 (notch2)
From Wikisequences
Sequence notch2 | |
---|---|
Target | notch2 ( Danio rerio ) |
Description | |
Design | morpholino |
Chemistry | pmApmGpmGpmTpmGpmApmApmCpmApmCpmTpmTpmApmCpmTpmTpmCpmApmTpmGpmCpmCpmApmApmA |
Sequence | (25b) AGGTGAACACTTACTTCATGCCAAA |
Application | gene silencing |
Name | notch2 |
References
Development and Notch signaling requirements of the zebrafish choroid plexus.Bill BR, Balciunas D, McCarra JA, Young ED, Xiong T, Spahn AM, Garcia-Lecea M, Korzh V, Ekker SC, Schimmenti LA.PLoS One. 2008 Sep 3;3(9) :e3114. doi: 10.1371/journal.pone.0003114.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478