Sequence 978 (shSmad4 4 , shSmad44)
From Wikisequences
Sequence shSmad4_4 , shSmad44 | |
---|---|
Target | NPY ( Gallus gallus ) |
Description | Neuropeptide Y |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) GCACGTCAAGTATTGCCAGTTCAAGAGACTGGCAATACTTGACGTGCTT |
Application | gene silencing |
Name | shSmad4_4 , shSmad44 |
References
Plasmid-based short-hairpin RNA interference in the chicken embryo.Chesnutt C, Niswander L.Genesis. 2004 Jun;39(2) :73-8.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478