Sequence 994 (OGT2)
From Wikisequences
Sequence OGT2 | |
---|---|
Target | Ogt ( Mus musculus ) |
Description | O-linked N-acetylglucosamine ( GlcNAc ) transferase ( UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase )
Ensembl: ENSMUSG00000034160 UniGene: Mm.259191 EntrezGene: 108155 Ensembl ChrX: 98835403 - 98879688 Strand: 1 GO terms: 0005515 0005622 0005634 0005737 0006396 0006493 0008080 0016757 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GTTTGAGCCCAAATCATGCTT / siRNA antisense (21b) GCATGATTTGGGCTCAAACTT |
Application | gene silencing |
Name | OGT2 |
References
Dynamic O-GlcNAc modification of nucleocytoplasmic proteins in response to stress. A survival response of mammalian cells.Zachara NE, O'Donnell N, Cheung WD, Mercer JJ, Marth JD, Hart GW.J Biol Chem. 2004 Jul 16;279(29) :30133-42. Epub 2004 May 11.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478