Browse wiki
Sequence 1064(RasGRP1-RNAi1503 , RasGRP1RNAi1503) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | RAS guanyl releasing protein 1 ( calcium a … RAS guanyl releasing protein 1 ( calcium and DAG-regulated ) Ensembl: ENSG00000172575 UniGene: Hs.591127 EntrezGene: 10125 Ensembl Chr15: 36567590 - 36644224 Strand: -1 GO terms: 0005085 0005088 0005509 0005515 0005622 0005624 0007242 0007264 0007265 0008270 0008289 005105642 0007264 0007265 0008270 0008289 0051056 |
Design | ShRNA + |
Name | RasGRP1-RNAi1503 , RasGRP1RNAi1503 + |
Sequence | (63b) GATCCCGATTGCTGCGAGTTTTCCATTCAAGAGATGGAAAACTCGCAGCAATCTTTTTGGAAA |
Target | RASGRP1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:27 + |
hide properties that link here |
No properties link to this page. |