Browse wiki
Sequence 1067(siRb1-1 , siRb11) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Retinoblastoma 1 ( including osteosarcoma … Retinoblastoma 1 ( including osteosarcoma ) Ensembl: ENSG00000139687 UniGene: Hs.408528 EntrezGene: 5925 Ensembl Chr13: 47775884 - 47954027 Strand: 1 GO terms: 0000075 0000082 0000122 0000279 0000785 0003700 0003713 0005515 0005634 0005667 0005819 0006350 0006469 0007049 0007050 0008134 0008285 0016564 0016568 0016605 0019900 0030308 003052164 0016568 0016605 0019900 0030308 0030521 |
Design | SiRNA + |
Name | siRb1-1 , siRb11 + |
Sequence | siRNA sense (21b) GATACCAGATCATGTCAGATT / siRNA antisense (21b) TCTGACATGATCTGGTATCTT |
Target | RB1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:05 + |
hide properties that link here |
No properties link to this page. |