Browse wiki
Sequence 1080(RhoA-3 , RhoA3) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Ras homolog gene family, member A Ensembl … Ras homolog gene family, member A Ensembl: ENSRNOG00000012630 UniGene: Rn.107401 EntrezGene: 117273 Ensembl Chr2: 200047945 - 200054372 Strand: 1 GO terms: 0000166 0003924 0004871 0005515 0005525 0005622 0005634 0005856 0005886 0007264 0030036 0043123 004566556 0005886 0007264 0030036 0043123 0045665 |
Design | SiRNA + |
Name | RhoA-3 , RhoA3 + |
Sequence | siRNA sense (21b) GGCGGGAGTTAGCCAAAATTT / siRNA antisense (21b) ATTTTGGCTAACTCCCGCCTT |
Target | Rhoa ( Rattus norvegicus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:24 + |
hide properties that link here |
No properties link to this page. |