Browse wiki

Jump to: navigation, search
Sequence 1105(S6K1)
Application Gene silencing +
Chemistry RNA +
Description Ribosomal protein S6 kinase, 70kDa, polypeRibosomal protein S6 kinase, 70kDa, polypeptide 1 Ensembl: ENSG00000108443 UniGene: Hs.463642 EntrezGene: 6198 Ensembl Chr17: 55325225 - 55382564 Strand: 1 GO terms: 0000166 0004672 0004674 0004713 0005524 0005737 0006468 0007165 0007281 0016740 0019717 0030054 0043491 004520281 0016740 0019717 0030054 0043491 0045202
Design ShRNA +
Name S6K1  +
Sequence (56b) GGTACTTGGTAAAGGGGGCTTTCAAGCTTAGCCCCCTTTACCAAGTACCCTTTTTG
Target RPS6KB1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:26  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders