Browse wiki
| Sequence 1106(S6K1-p70 , S6K1p70) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Design | SiRNA + |
| Name | S6K1-p70 , S6K1p70 + |
| Sequence | siRNA sense (21b) AGCATGGACCATGGGGGAGTT / siRNA antisense (21b) CTCCCCCATGGTCCATGCTTT |
| Target | RPS6KB1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:22 + |
| hide properties that link here |
| No properties link to this page. |
