Browse wiki
| Sequence 1146(Control-2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Superoxide dismutase 1 Ensembl: ENSRNOG00000002115 UniGene: Rn.6059 EntrezGene: 24786 |
| Design | ShRNA + |
| Name | Control-2 + |
| Sequence | (57b) GGAGACCGTAGGACGTGAAATTCAAGCTTATTTCACGTCCTACGGTCTCCCTTTTTG |
| Target | Sod1 ( Rattus norvegicus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:18 + |
| hide properties that link here |
| No properties link to this page. |
