Browse wiki

Jump to: navigation, search
Sequence 115 (CLSTR10547r1 cieg046p10 162)
Application Gene silencing +
Chemistry PmCpmApmCpmCpmApmGpmCpmTpmApmTpmCpmApmCpmApmTpmCpmGpmCpmCpmTpmGpmCpmCpmApmT +
Design Morpholino +
Name CLSTR10547r1_cieg046p10_162  +
Sequence (25b) CACCAGCTATCACATCGCCTGCCAT
Target AK115360 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:38  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20115-20(CLSTR10547r1-20cieg046p10-20162)"