Browse wiki
| Sequence 1151(siSRC.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | V-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) Ensembl: ENSG00000049323 |
| Design | SiRNA + |
| Name | siSRC.2 + |
| Sequence | siRNA sense (21b) GCTTGTGGGTGATGTTTGATT / siRNA antisense (21b) TCAAACATCACCCACAAGCCG |
| Target | SRC (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:57 + |
| hide properties that link here |
| No properties link to this page. |
