Browse wiki
| Sequence 1153(siSRP54d) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Signal recognition particle 54kDa Ensembl: ENSG00000054219 UniGene: Hs.167535 EntrezGene: 6729 Ensembl Chr2: 160368122 - 160469493 Strand: -1 GO terms: 0004872 0005529 0005887 0006897 0006954 0006955 0016020 |
| Design | SiRNA + |
| Name | siSRP54d + |
| Sequence | siRNA sense (21b) GCAAGAGGATCGGGTGTATTT / siRNA antisense (21b) ATACACCCGATCCTCTTGCTT |
| Target | SRP54 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:01 + |
| hide properties that link here |
| No properties link to this page. |
