Browse wiki

Jump to: navigation, search
Sequence 1160(SSRdelta-2)
Application Gene silencing +
Chemistry PmTpmApmGpmTpmGpmApmTpmCpmTpmTpmGpmCpmTpmTpmApmApmGpmGpmTpmGpmApmCpmApmG +
Design Morpholino +
Name SSRdelta-2  +
Sequence (24b) TAGTGATCTTGCTTAAGGTGACAG
Target SSRdelta ( Danio rerio ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:06  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-201160(SSRdelta-2D2)"