Browse wiki
| Sequence 1164(SSU05 0083) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Design | Primer set + |
| Name | SSU05_0083 + |
| Sequence | Forward PCR primer (18b) GGCTTCCGTCTTCGTGAG / Reverse PCR primer (24b) AAGTGAAACTGTAACCAATTTGTC |
| Target | SSU05 0083 ( Streptococcus suis ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:27 + |
| hide properties that link here |
| No properties link to this page. |
