Browse wiki
Sequence 1170(SSU05 0479) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Design | Primer set + |
Name | SSU05_0479 + |
Sequence | Forward PCR primer (20b) AGTGCTGGCGTCAAAGATGG / Reverse PCR primer (23b) TGAAGAAGGTTGGCAGGTAATCC |
Target | SSU05 0479 ( Streptococcus suis ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:27 + |
hide properties that link here |
No properties link to this page. |