Browse wiki
| Sequence 1175(b3a2 1 , b3a21) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | SGT1, suppressor of G2 allele of SKP1 ( S. … SGT1, suppressor of G2 allele of SKP1 ( S. cerevisiae ) Ensembl: ENSG00000074803 UniGene: Hs.281902 EntrezGene: 10910 Ensembl Chr15: 46285791 - 46383567 Strand: 1 GO terms: 0004413 0005215 0005515 0005524 0005624 0005886 0006566 0006810 0006811 0006813 0006814 0006821 0006835 0008152 0008511 0015293 0015377 0016020 0016021 0016740 0017153 0030955 003140220 0016021 0016740 0017153 0030955 0031402 |
| Design | SiRNA + |
| Name | b3a2_1 , b3a21 + |
| Sequence | siRNA sense (21b) GCAGAGTTCAAAAGCCCTTTT / siRNA antisense (21b) AAGGGCTTTTGAACTCTGCTT |
| Target | SUGT1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:22 + |
| hide properties that link here |
| No properties link to this page. |
