Browse wiki
| Sequence 1184(SytI-1 , SytI1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Synaptotagmin I Ensembl: ENSMUSG000000358 … Synaptotagmin I Ensembl: ENSMUSG00000035864 UniGene: Mm.289702 EntrezGene: 20979 Ensembl Chr10: 107934706 - 108448031 Strand: -1 GO terms: 0005215 0005509 0005515 0005516 0005543 0005544 0005737 0005886 0006810 0007269 0008021 0016020 0016021 0030054 0030141 0030672 0031410 0042734 0042802 0043005 0045202 005075010 0042734 0042802 0043005 0045202 0050750 |
| Design | ShRNA + |
| Name | SytI-1 , SytI1 + |
| Sequence | (49b) GCTGAAGCAGAAGTTTATGTTCAAGAGACATAAACTTCTGCTTCAGCTT |
| Target | Syt1 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:28 + |
| hide properties that link here |
| No properties link to this page. |
