Browse wiki
Sequence 1189(shTH1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Tyrosine hydroxylase Ensembl: ENSRNOG0000 … Tyrosine hydroxylase Ensembl: ENSRNOG00000020410 UniGene: Rn.11082 EntrezGene: 25085 Ensembl Chr1: 203164250 - 203171506 Strand: -1 GO terms: 0001666 0001963 0004497 0004511 0005634 0005737 0005829 0006585 0007268 0007507 0007612 0007613 0007617 0007626 0008016 0008021 0008198 0008199 0009072 0009887 0016597 0035240 004213699 0009072 0009887 0016597 0035240 0042136 |
Design | ShRNA + |
Name | shTH1 + |
Sequence | (93b) AAAAAAACCAGGCCTCCACTGAGCACCCCGAAGCGCAAGCTTCCGCTTCGAGGTGCCCAGTGGAGACCTGGCGGTGTTTCGTCCTTTCCACAA |
Target | Th ( Rattus norvegicus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:27 + |
hide properties that link here |
No properties link to this page. |