Browse wiki

Jump to: navigation, search
Sequence 1189(shTH1)
Application Gene silencing +
Chemistry RNA +
Description Tyrosine hydroxylase Ensembl: ENSRNOG0000Tyrosine hydroxylase Ensembl: ENSRNOG00000020410 UniGene: Rn.11082 EntrezGene: 25085 Ensembl Chr1: 203164250 - 203171506 Strand: -1 GO terms: 0001666 0001963 0004497 0004511 0005634 0005737 0005829 0006585 0007268 0007507 0007612 0007613 0007617 0007626 0008016 0008021 0008198 0008199 0009072 0009887 0016597 0035240 004213699 0009072 0009887 0016597 0035240 0042136
Design ShRNA +
Name shTH1  +
Sequence (93b) AAAAAAACCAGGCCTCCACTGAGCACCCCGAAGCGCAAGCTTCCGCTTCGAGGTGCCCAGTGGAGACCTGGCGGTGTTTCGTCCTTTCCACAA
Target Th ( Rattus norvegicus ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:27  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders