Browse wiki

Jump to: navigation, search
Sequence 119 (CLSTR07626r1 cieg023k03 148)
Application Gene silencing +
Chemistry PmTpmTpmGpmCpmApmGpmCpmCpmCpmGpmApmApmCpmTpmTpmTpmTpmGpmTpmTpmTpmCpmCpmApmT +
Design Morpholino +
Name CLSTR07626r1_cieg023k03_148  +
Sequence (25b) TTGCAGCCCGAACTTTTGTTTCCAT
Target AK115517 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:18:23  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20119-20(CLSTR07626r1-20cieg023k03-20148)"