Browse wiki
| Sequence 1194(TNFRSF11B) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Tumor necrosis factor receptor superfamily … Tumor necrosis factor receptor superfamily, member 11b ( osteoprotegerin ) Ensembl: ENSG00000164761 UniGene: Hs.81791 EntrezGene: 4982 Ensembl Chr8: 120004978 - 120033492 Strand: -1 GO terms: 0001501 0004872 0004888 0005125 0005515 0005576 0005578 0006915 0006955 0007165 0016020 004248978 0006915 0006955 0007165 0016020 0042489 |
| Design | Primer set + |
| Name | TNFRSF11B + |
| Sequence | Forward PCR primer (20b) TGGCACCAAAGTAAACGCAG / Reverse PCR primer (20b) CTCCCACTTTCTTTCCCGGT |
| Target | TNFRSF11B ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:18 + |
| hide properties that link here |
| No properties link to this page. |
