Browse wiki
| Sequence 1201(p53) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Tumor protein p53 ( Li-Fraumeni syndrome ) … Tumor protein p53 ( Li-Fraumeni syndrome ) Ensembl: ENSG00000141510 UniGene: Hs.654481 EntrezGene: 7157 Ensembl Chr17: 7512445 - 7531642 Strand: -1 GO terms: 0000060 0000739 0001701 0001836 0003677 0003700 0004518 0005507 0005515 0005524 0005626 0005634 0005654 0005657 0005730 0005737 0005739 0005783 0005829 0006284 0006289 0006350 000635583 0005829 0006284 0006289 0006350 0006355 |
| Design | Primer set + |
| Name | p53 + |
| Sequence | Forward PCR primer (20b) CAGCACATGACGGAGGTTGT / Reverse PCR primer (21b) TCATCCAAATACTCCACACGC |
| Target | TP53 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 23:37:03 + |
| hide properties that link here |
| No properties link to this page. |
