Browse wiki
| Sequence 1216(TSPAN18) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Tetraspanin 18 Ensembl: ENSG00000157570 UniGene: Hs.385634 EntrezGene: 90139 Ensembl Chr11: 44838451 - 44909450 Strand: 1 GO terms: 0005615 0006810 0016020 0016021 |
| Design | Primer set + |
| Name | TSPAN18 + |
| Sequence | Forward PCR primer (20b) AAGGGAAAGACACCAGTGGA / Reverse PCR primer (21b) CCCCGCCCAGAAATATGAAGA |
| Target | TSPAN18 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:18 + |
| hide properties that link here |
| No properties link to this page. |
