Browse wiki

Jump to: navigation, search
Sequence 122 (CLSTR14126r1 citb033n18 192)
Application Gene silencing +
Chemistry PmCpmApmTpmGpmGpmCpmApmApmGpmCpmGpmGpmCpmTpmGpmCpmTpmApmApmTpmTpmTpmApmApmC +
Design Morpholino +
Name CLSTR14126r1_citb033n18_192  +
Sequence (25b) CATGGCAAGCGGCTGCTAATTTAAC
Target AK115569 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:24  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20122-20(CLSTR14126r1-20citb033n18-20192)"