Browse wiki
Sequence 1220(ICBP90-1 , ICBP901) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Ubiquitin-like, containing PHD and RING fi … Ubiquitin-like, containing PHD and RING finger domains, 1 Ensembl: ENSG00000034063 UniGene: Hs.108106 EntrezGene: 29128 Ensembl Chr19: 4860510 - 4913162 Strand: 1 GO terms: 0003700 0003702 0005515 0005634 0006281 0006350 0006357 0006464 0006512 0007049 0008270 0008283 0016874 004687212 0007049 0008270 0008283 0016874 0046872 |
Design | SiRNA + |
Name | ICBP90-1 , ICBP901 + |
Sequence | siRNA sense (21b) GATCCAGGAGCTGTTCCACTT / siRNA antisense (21b) GTGGAACAGCTCCTGGATCTT |
Target | UHRF1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:18 + |
hide properties that link here |
No properties link to this page. |