Browse wiki
| Sequence 1225(TI-VAMP 2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Synaptobrevin-like 1 Ensembl: ENSG00000124333 UniGene: Hs.24167 , Hs.606538 EntrezGene: 6845 Ensembl ChrX: 154764144 - 154826626 Strand: 1 GO terms: 0005783 0005794 0006810 0008150 0015031 0016020 0016021 0016192 0045177 |
| Design | ShRNA + |
| Name | TI-VAMP_2 + |
| Sequence | (70b) AGATCTCCGGAATCATGGTCAGAAACATTCAAGAGATGTTTCTGACCATGATTCCTTTTTGGAAAAGCTT |
| Target | VAMP7 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:22 + |
| hide properties that link here |
| No properties link to this page. |
