Browse wiki
| Sequence 1233(VITO-1 , VITO1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Vestigial like 2 homolog ( Drosophila ) Ensembl: ENSMUSG00000049641 UniGene: Mm.87237 EntrezGene: 215031 Ensembl Chr10: 51742337 - 51748154 Strand: 1 GO terms: 0003713 0005515 0005634 0005737 0006355 0007519 0030528 0045449 0045944 |
| Design | ShRNA + |
| Name | VITO-1 , VITO1 + |
| Sequence | (64b) GATCCCCGACATCAGCTCTGTGGTGGTTCAAGAGACCACCACAGAGCTGATGTCTTTTTGGAAA |
| Target | Vgll2 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:17 + |
| hide properties that link here |
| No properties link to this page. |
