Browse wiki
Sequence 1247(siWAVE3-b , siWAVE3b) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | WAS protein family, member 3 Ensembl: ENSG00000118515 |
Design | SiRNA + |
Name | siWAVE3-b , siWAVE3b + |
Sequence | siRNA sense (21b) GAGGTCTCACTACAGGATATT / siRNA antisense (21b) TATCCTGTAGTGAGACCTCTT |
Target | WASF3 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:10 + |
hide properties that link here |
No properties link to this page. |