Browse wiki

Jump to: navigation, search
Sequence 125 (CLSTR11771r1 cieg055k01 172)
Application Gene silencing +
Chemistry PmTpmCpmTpmTpmTpmGpmCpmGpmApmApmApmCpmApmApmTpmCpmApmTpmTpmTpmCpmTpmGpmTpmC +
Design Morpholino +
Name CLSTR11771r1_cieg055k01_172  +
Sequence (25b) TCTTTGCGAAACAATCATTTCTGTC
Target AK115668 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:29  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20125-20(CLSTR11771r1-20cieg055k01-20172)"