Browse wiki
| Sequence 1263(XLOC 010969 , XLOC010969) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Design | Primer set + |
| Name | XLOC_010969 , XLOC010969 + |
| Sequence | Forward PCR primer (21b) CGAGTGACTTGTTCAACGAGA / Reverse PCR primer (21b) TTCCTACGGGCAGTATCATCA |
| Target | XLOC 010969 ( Nicotiana benthamiana ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:26 + |
| hide properties that link here |
| No properties link to this page. |
