Browse wiki
Sequence 1265(XLOC 013974 , XLOC013974) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Design | Primer set + |
Name | XLOC_013974 , XLOC013974 + |
Sequence | Forward PCR primer (21b) CATTGAAAGATCGACGAGGAC / Reverse PCR primer (21b) ATTTGGCATTGAGAATCTGCT |
Target | XLOC 013974 ( Nicotiana benthamiana ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:15 + |
hide properties that link here |
No properties link to this page. |