Browse wiki

Jump to: navigation, search
Sequence 1269(XLOC 023632 , XLOC023632)
Application Gene expression +
Chemistry DNA +
Design Primer set +
Name XLOC_023632 , XLOC023632  +
Sequence Forward PCR primer (23b) ACAAATATGTCCGCCACAATGCC / Reverse PCR primer (19b) CTCCGCCTGCTCCTCCTGT
Target XLOC 023632 ( Nicotiana benthamiana ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:28  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders