Browse wiki
Sequence 1269(XLOC 023632 , XLOC023632) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Design | Primer set + |
Name | XLOC_023632 , XLOC023632 + |
Sequence | Forward PCR primer (23b) ACAAATATGTCCGCCACAATGCC / Reverse PCR primer (19b) CTCCGCCTGCTCCTCCTGT |
Target | XLOC 023632 ( Nicotiana benthamiana ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:28 + |
hide properties that link here |
No properties link to this page. |