Browse wiki
| Sequence 1274(XLOC 025321 , XLOC025321) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Design | Primer set + |
| Name | XLOC_025321 , XLOC025321 + |
| Sequence | Forward PCR primer (22b) AAGCTGCTGATATAAATGCACT / Reverse PCR primer (19b) CACGCCCAGATCCCATCAC |
| Target | XLOC 025321 ( Nicotiana benthamiana ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:16 + |
| hide properties that link here |
| No properties link to this page. |
