Browse wiki

Jump to: navigation, search
Sequence 129 (CLSTR04765r1 cilv010g23 114)
Application Gene silencing +
Chemistry PmCpmApmTpmGpmCpmTpmTpmApmTpmTpmTpmTpmGpmCpmCpmCpmTpmApmTpmApmTpmGpmCpmC +
Design Morpholino +
Name CLSTR04765r1_cilv010g23_114  +
Sequence (24b) CATGCTTATTTTGCCCTATATGCC
Target AK115851 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:24  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20129-20(CLSTR04765r1-20cilv010g23-20114)"