Browse wiki

Jump to: navigation, search
Sequence 130 (CLSTR09939r1 cieg017e06 159)
Application Gene silencing +
Chemistry PmGpmApmCpmApmTpmApmApmCpmCpmApmApmGpmTpmCpmApmGpmApmApmGpmApmApmTpmCpmApmT +
Design Morpholino +
Name CLSTR09939r1_cieg017e06_159  +
Sequence (25b) GACATAACCAAGTCAGAAGAATCAT
Target AK116288 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:10  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20130-20(CLSTR09939r1-20cieg017e06-20159)"