Browse wiki

Jump to: navigation, search
Sequence 134 (CLSTR13121r1 cicl057g13 184)
Application Gene silencing +
Chemistry PmTpmCpmGpmGpmTpmTpmTpmGpmTpmTpmTpmGpmCpmApmGpmTpmTpmTpmCpmApmCpmTpmCpmApmT +
Design Morpholino +
Name CLSTR13121r1_cicl057g13_184  +
Sequence (25b) TCGGTTTGTTTGCAGTTTCACTCAT
Target AK116605 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:42  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20134-20(CLSTR13121r1-20cicl057g13-20184)"